Smacc no jumper.
Somebody explain this shit to me. Smacc on live rn saying T Rell changed his life with Back On Figg real thankful and shit. But ain’t he School Boy Q’s brother? Q ain’t help him get …
Jul 15, 2022 · Pun comes for Josh, trying to tell him how to run his business, knowing they already had that same convo prior to the show, but Josh has receipts and doesn't... Adam calls FMW,BOF, Cuhmunity nothing but No Jumper reaction channels 🔫🔫🔫💥💥💥 ... SMACC got a message for Adam 😂still prayers up for smacky🙏🏽 ... The ego on this guy…no one knows or gives a fuck about you nigga. No-Housing3018Smacc and Trell trash talk each other on livestream upvotes ... Yuriy calls sharp a bitch & thinks No Jumper needs $5k from him🚨 0:55.About Press Copyright Contact us Creators Advertise Developers Terms Privacy Policy & Safety How YouTube works Test new features NFL Sunday Ticket Press Copyright ...
A podcast can’t succeed and continue to grow if there’s no substance in it. He’s just a regular dude from the streets that hasn’t been able to get himself out of them because he just don’t got talent in anything. Shxts sad that TRell now forced to keep him on for fear of ppl leaving because they loved Smacc for what he is. This world is inhabited by creatures called Pokémon - and people love to post about them online! This subreddit is for posts that simulate social media in the Pokémon universe, everything from yesterday's r/asktrainers question to today's PokeTwitter Drama. isn't it crazy how smacc doesn't know who van is, when van runs the back on figg pages,clips,youtube,instagram... & smacc on episode 136 of back on figg has no clue who that is... proof that smacc is a fucking employee & everything is on a need to know basis lol. smacc aint no boss gtfo loll discussion
Smacc to Bricc Baby: “Crash out bitch, kill yourself”. NO JUMPER REACTS. Sort by: Add a Comment. Particular_Desk_8380. • 2 mo. ago. See this is where smac look like a buster, bc we all seen how sensitive his lil retarded ass got when adam told him he could die in the hospital, 123. Reply.67K subscribers in the NoJumper community. Subreddit for The Coolest Podcast In The World.
Wow smacc is actually slow i come in peace ☮️ Locked post. New comments cannot be posted. Share Sort by: Best. Open comment sort options. Best. Top. New. Controversial. Old. Q&A. Add a Comment. ... No Jumper been …The Coolest Podcast In The World New videos posted DAILYHosted by @Adam22 subscribe to his channel here: http://www.youtube.com/adam22foreverFollow us on Sou... Don’t miss out on a Winning Season, head to MyBookie and use my promo code AED and you’ll get double your first deposit mybookie.agFOLLOW ADhttps://www.insta... 1,512 likes, 97 comments - nojumper on May 4, 2024: "Fans were chanting “F-ck Drake” at #ScHoolboyQ’s concert last night •@aintyoumalcom".
AD, smacc and do know was hating on trell. cancel christmas Closed • total votes Yup they can’t handle him leading . Nah they just joking around . Voting closed ... they did a 5 hour live stream yesterday & suspect was still "driving to no jumper" where the fuck he coming from New York? Suspect is a fucking clown, never showed up & called ...
Advertisement In the United States, approximately 2 million people get help each year for alcoholism. Alcoholism treatment may include: The effectiveness of these programs varies d...
Smacc make everything about him and wouldn’t allow the girls to perform for a few minutes. Besides, Smacc been fuckin up all stream. He made fun of TRell’s arm numerous times, tried to shit on Jack and said Heather not a better content creator than him. SMACC was pouting the entire time and he is definitely entitled but he comes in peaceUHF (ultra high frequency) receivers are able to detect different kinds of radio signals in the UHF band of the radio frequency spectrum. FM receivers are used to decode frequency-...The reason BOF/T-Rell/Smacc/Mackwop & the homies are so likable is that compared to everything and everyone else in the NJ universe, their friendship is real & organic. Their energy is closer to when you 1st heard desus x mero than of these other streaming podcasts ... I'm more of a bof fan but but both shows are based around reactions and no ...Jul 25, 2023 ... T-Rell And Smac Call In To Talk About BANNING Milk74 & PNO And Smac Arguing ... DAY IN THE LIFE WITH SMACC. BACKONFIGG•108K ... No Jumper•205K views.I like BOF but trell letting Smacc talk down on Milk is crazy seems like they needed some type of beef to keep fans to tune in Reply SneakyBastardx Sceezus Christ • Additional comment actions ... T-Rell responds to Adam’s IG post and says he will surpass No Jumper. Jealous-Ad4346
Smacc starts Crying 😢 😳 and OG Cuicide appears out of thin air. Apparently OG Cuicide has been going around and whispering "let it out, loved one", causing people to cry on demand. Legend has it. Lmao. Og spawning after the tears had me dying. I like BOF but trell letting Smacc talk down on Milk is crazy seems like they needed some type of beef to keep fans to tune in Reply SneakyBastardx Sceezus Christ • Additional comment actions ... T-Rell responds to Adam’s IG post and says he will surpass No Jumper. Jealous-Ad4346242 Online. 519 votes, 54 comments. 64K subscribers in the NoJumper community. Subreddit for The Coolest Podcast In The World.Advertisement In the United States, approximately 2 million people get help each year for alcoholism. Alcoholism treatment may include: The effectiveness of these programs varies d... The Coolest Podcast In The World New videos posted DAILYHosted by @Adam22 subscribe to his channel here: http://www.youtube.com/adam22foreverFollow us on Sou... Bro it’s looking like no one will be left at no jumper but Lush and Housephone, the only two people who actually need no jumper to survive lol smac just cancelled himself and Figgmunity are clearly plotting on breaking away from NJ The Coolest Podcast In The World New videos posted DAILYHosted by @Adam22 subscribe to his channel here: http://www.youtube.com/adam22foreverFollow us on Sou...
As of 16th December 2023, trading of the SafeMoon token has been halted. This is an alternative subreddit for former investors who want to discuss both the good and bad of SafeMoon without the echo chamber. No ‘wen lambo', no 'sell and give me the reflections'. Criticism and skepticism is welcome.Smacc and Trell trash talk each other on livestream upvotes ... Adam & Suspect full argument on No Jumper News today🚨 6:18.
The greatest human leapers in the world are able to jump over a bar suspended nearly 8 feet off of the ground. While the world record consistently increased for a period of about 1...Keep in mind whenever some street shit happens in the media, flakko’s the first person to be on some incriminating ass shit and make it seem like the person did the crime without a doubt, but then in this situation with boom, THERES LITERALLY 4K evidence and hes trying to make excusesSmacc from No Jumper gets sucker punched while live streaming #smacc #nojumperpodcast #nojumper #fight #suckerpunch. thelampchannel · Original audioBusiness, Economics, and Finance. GameStop Moderna Pfizer Johnson & Johnson AstraZeneca Walgreens Best Buy Novavax SpaceX Tesla. CryptoSharp and Smac have a heart-to-heart in this very special conversation, where the two realize they're more alike than they thought.-----00:00 Intro0:05 Smac ...Being an Instagram influencer involves a surprising amount of office work. Instagram influencers have the power to make or break cultural trends, and brands are aware. Companies pa...Don’t get it fucked up, Smacc definitely Rookie of the Year, not Lush goofy ass. Flakko a strong 2nd but Smacc is not needed on ATEOTD. God forbid T Rell take a day off, he would add no value to the conversation. He only talks when T Rell includes him in the convo, and basically laughs every 5 minutes for no reason.Smacc and Trey Mentality. Can you say crash dummies? comment sorted by Best Top New Controversial Q&A Add a Comment. EASTSIDEBABY9 Sceezus Christ • Additional comment actions ... Adam calls FMW,BOF, Cuhmunity nothing but …Smacc got warned by all his friends and the Chat but he felt like people was doubting him or something. I never wish bad luck on people but ever since he made that video of “I don’t drink and drive my motorcycle, I only do that with my car” I knew something crazy would happen, but it’s hard to tell a grown man what to do and the sad truth was he only joined that shot just so he could ...Chamberlain’s MyQ Smart Garage Hub makes any garage door opener smart. Expert Advice On Improving Your Home Videos Latest View All Guides Latest View All Radio Show Latest View All...
Get 20% Off and Free Shipping with the code SHARPTANK at http://www.Manscaped.comSharp and T-Rell turned an impromptu interview into a super raw conversation...
They’re the biggest street dudes on no jumper is such a dick sucking statement. AD has more street credibility than TRell. And smack is just the friend that they treated like a retard growing up so what street credibility does Smacc have lmao. If he had street cred, he wouldn’t be complaining about being seen as a joke
Remember when smacc said “that’s how stupid they is” talking about their fans? They be flexing their bread so hard on us any motherfucker who donates should kill thwmselves. Plus isn’t school boy a his “brother”?Milk says Smacc was talking shit about Adam before joining No Jumper 😯😯😯. This clown mad cuz smack tried to get a job. Milk never have this energy when he talk to these dudes in person…guarantee if he ever on a Monday he gonna come in peace acting awkward. Idk BoF really don’t need to have this moron on. Smacc is closer to the broke and bum homies from the hood than he is to someone who’s successful. Someone said, “good I hope he learns to stay away”. At 30+ years old it shouldn’t take you getting beat up by losers to teach you a lesson. Smacc ain’t nothing but a hood Nigga on a live stream. He really ain’t shit in life lol. Jan 6, 2024 ... ... Smac's Instagram: https ... - Smac's Wife FINALLY Calls In. 23K views · 2 ... No Jumper•69K views · 12:46. Go to channel · Jay ...Google My Business merchants will soon be able to start booking appointments through their business panels when customers find them in search. Google My Business will begin allowin...Smacc’ s car just got repo’d. Yuri always saying he and Rylee broke and in debt. Everyone else got a Gofundme or scam in the works bc they can’t pay for pretty basic thingsDon’t miss out on a Winning Season, head to MyBookie and use my promo code AED and you’ll get double your first deposit mybookie.agFOLLOW ADhttps://www.insta...Smacc & PNO Have Heated Argument Things go LeftStreaming every week Monday & Friday at 4PM where you'll find Rawest in the game covering all current events, ...Adam put money on 03’s books and didn’t have to post it or anything it was just genuine. Smacc in the hospital crying calling into bof so his friends could just visit him that’s a big difference in friendship/loyalty 🤣🤣🤣 I hope he loses his leg so he can finally be humbleAdam put money on 03’s books and didn’t have to post it or anything it was just genuine. Smacc in the hospital crying calling into bof so his friends could just visit him that’s a big difference in friendship/loyalty 🤣🤣🤣 I hope he loses his leg so he can finally be humble
A jumper wire is a conducting wire used to transfer electrical signals between two points in a circuit. The wires can either be used to modify circuits or to diagnose problems with... isn't it crazy how smacc doesn't know who van is, when van runs the back on figg pages,clips,youtube,instagram... & smacc on episode 136 of back on figg has no clue who that is... proof that smacc is a fucking employee & everything is on a need to know basis lol. smacc aint no boss gtfo loll discussion Jul 25, 2023 ... T-Rell And Smac Call In To Talk About BANNING Milk74 & PNO And Smac Arguing ... DAY IN THE LIFE WITH SMACC. BACKONFIGG•108K ... No Jumper•205K views.Instagram:https://instagram. horse vtuberguitar center central dallaswhat is wrong with the following piece of mrna taccaggatcactttgccaap gov unit 1 practice test mcq SMACC is on BoF multiple times talking Abt how much money he has from FMW and shit, but he lives with his mom and didn't get on the LLC cuz it will take his monthly retard check, and who knows what kinda child support it'll trigger... dishwasher beeping and not startingoverstock commenity The real shitty cuh. Smacc came out the gate firing. Nigga got comfortable, started missing out on episodes. Became a motorcycle rider (knowing damn that requires a certain level of intelligence). Almost lost his foot, started crying about missing out on episodes (shit he took for granted). Still can’t do shit about shit. The Coolest Podcast In The World New videos posted DAILYHosted by @Adam22 subscribe to his channel here: http://www.youtube.com/adam22foreverFollow us on Sou... groomers kennewick Nah smacc is like 5-6 years older Reply Disastrous_Lawyer_24 Yerrrdamean • ... The New No Jumper Show without Lush got me like : Dry_Tax8191I like BOF but trell letting Smacc talk down on Milk is crazy seems like they needed some type of beef to keep fans to tune in Reply SneakyBastardx Sceezus Christ • Additional comment actions ... T-Rell responds to Adam’s IG post and says he will surpass No Jumper. Jealous-Ad4346Adam put money on 03’s books and didn’t have to post it or anything it was just genuine. Smacc in the hospital crying calling into bof so his friends could just visit him that’s a big difference in friendship/loyalty 🤣🤣🤣 I hope he loses his leg so he can finally be humble